Skip to main content

Flag-ciBAR1
(Plasmid #200440)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 200440 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pCD-betaG-FLAG
  • Backbone size w/o insert (bp) 4118
  • Total vector size (bp) 4988
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ciBAR1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    870
  • Promoter CMV
  • Tag / Fusion Protein
    • Flag (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer GCGTGCCTAATGGGAGGTCT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Flag-ciBAR1 was a gift from Ken-Ichi Takemaru (Addgene plasmid # 200440 ; http://n2t.net/addgene:200440 ; RRID:Addgene_200440)
  • For your References section:

    BAR Domain-Containing FAM92 Proteins Interact with Chibby1 To Facilitate Ciliogenesis. Li FQ, Chen X, Fisher C, Siller SS, Zelikman K, Kuriyama R, Takemaru KI. Mol Cell Biol. 2016 Oct 13;36(21):2668-2680. doi: 10.1128/MCB.00160-16. Print 2016 Nov 1. 10.1128/MCB.00160-16 PubMed 27528616