This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #89472)


Item Catalog # Description Quantity Price (USD)
Plasmid 89472 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 5800
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    human Chibby1
  • Species
    H. sapiens (human)
  • Entrez Gene
    CBY1 (a.k.a. C22orf2, CBY, Chibby1, HS508I15A, PGEA1, PIGEA-14, PIGEA14, arb1)
  • Tag / Fusion Protein
    • GFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer ACCACATGGTCCTTCTTCAG
  • 3′ sequencing primer TTATGCTGAGTGATATC
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

A human Chibby1 cDNA including its 3' UTR was subcloned into the V8 BB.GFPLT CS2+ vector (Addgene plasmid #17099).

The insert can be sequenced using the following primers: forward (GFP primer), ACCACATGGTCCTTCTTCAG;
reverse (T7 primer), TTATGCTGAGTGATATC.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GFP-hChibby1 was a gift from Ken-Ichi Takemaru (Addgene plasmid # 89472 ; ; RRID:Addgene_89472)