GFP-hChibby1
(Plasmid
#89472)
-
PurposeLabels mother centrioles/basal bodies
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89472 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCS2+
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 5800
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman Chibby1
-
SpeciesH. sapiens (human)
-
Entrez GeneCBY1 (a.k.a. C22orf2, CBY, Chibby1, HS508I15A, PGEA1, PIGEA-14, PIGEA14, arb1)
-
Tag
/ Fusion Protein
- GFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer ACCACATGGTCCTTCTTCAG
- 3′ sequencing primer TTATGCTGAGTGATATC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
A human Chibby1 cDNA including its 3' UTR was subcloned into the V8 BB.GFPLT CS2+ vector (Addgene plasmid #17099).
The insert can be sequenced using the following primers: forward (GFP primer), ACCACATGGTCCTTCTTCAG;
reverse (T7 primer), TTATGCTGAGTGATATC.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GFP-hChibby1 was a gift from Ken-Ichi Takemaru (Addgene plasmid # 89472 ; http://n2t.net/addgene:89472 ; RRID:Addgene_89472)