CLIPf-KIF5B-SNAPf-HisTag-FLAG
(Plasmid
#200799)
-
PurposeMammalian expression of CLIPf-KIF5B-SNAPf-HisTag-FLAG
-
Depositing Lab
-
Depositing OrganizationUniversity of Sheffield
Located in the United Kingdom of Great Britain and Northern Ireland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 200799 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCLAP
- Backbone size w/o insert (bp) 6558
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKIF5B
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2892
-
Entrez GeneKIF5B (a.k.a. HEL-S-61, KINH, KNS, KNS1, UKHC)
- Promoter CMV & T7
-
Tags
/ Fusion Proteins
- CLIPf (N terminal on backbone)
- SNAPf, HisTag, FLAG (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer AGCGAGTCTCACCTGGCC
- 3′ sequencing primer TGCAGCCAGGTGGCTGTAGGA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.12.20.629623 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CLIPf-KIF5B-SNAPf-HisTag-FLAG was a gift from Alison Twelvetrees (Addgene plasmid # 200799 ; http://n2t.net/addgene:200799 ; RRID:Addgene_200799) -
For your References section:
Kinesin-1 is highly flexible and adopts an open conformation in the absence of cargo. Smith ER, Turner ED, Abdelhamid MAS, Craggs TD, Twelvetrees AE. iScience. 2026 Feb 2;29(3):114875. doi: 10.1016/j.isci.2026.114875. eCollection 2026 Mar 20. 10.1016/j.isci.2026.114875 PubMed 41732280