pGEX-6P-1_WT RAD23A
(Plasmid
#201456)
-
PurposeExpresses human RAD23A with an N-terminal GST tag in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 201456 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepGEX-6P-1
- Backbone size w/o insert (bp) 4984
- Total vector size (bp) 6073
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameUV excision repair protein RAD23 homolog A
-
SpeciesH. sapiens (human)
-
MutationCoding sequence has been optimised for expression in E. coli
-
Entrez GeneRAD23A (a.k.a. HHR23A, HR23A)
- Promoter tac promoter
-
Tag
/ Fusion Protein
- GST (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG
- 3′ sequencing primer GCTTACAGACAAGCTGTGACC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
GST tag is cleavable with rhinovirus 3C and PreScission proteases
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX-6P-1_WT RAD23A was a gift from Roger Woodgate (Addgene plasmid # 201456 ; http://n2t.net/addgene:201456 ; RRID:Addgene_201456) -
For your References section:
A novel interaction between RAD23A/B and Y-family DNA polymerases. Ashton NW, Jaiswal N, Cestari Moreno N, Semenova IV, D'Orlando DA, Teatin Latancia M, McIntyre J, Woodgate R, Bezsonova I. J Mol Biol. 2023 Nov 5:168353. doi: 10.1016/j.jmb.2023.168353. 10.1016/j.jmb.2023.168353 PubMed 37935254