Skip to main content

pRegev_ExonSkip_Backbone
(Plasmid #204187)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 204187 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    (None)
  • Total vector size (bp) 7524
  • Vector type
    Mammalian Expression
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    First exon and intron for beta globin splicing minigene
  • Species
    Synthetic
  • Insert Size (bp)
    234
  • Promoter Truncated CAG

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Minigene design from Kristen Lynch (SA Smith and KW Lynch, "Cell-based splicing of minigenes." (2014)). Backbone design modified from Georg Seelig (AB Rosenberg et al, "Learning the sequence determinants of alternative splicing from millions of random sequences." (2015)).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRegev_ExonSkip_Backbone was a gift from Oded Regev (Addgene plasmid # 204187 ; http://n2t.net/addgene:204187 ; RRID:Addgene_204187)
  • For your References section:

    Deciphering RNA splicing logic with interpretable machine learning. Liao SE, Sudarshan M, Regev O. Proc Natl Acad Sci U S A. 2023 Oct 10;120(41):e2221165120. doi: 10.1073/pnas.2221165120. Epub 2023 Oct 5. 10.1073/pnas.2221165120 PubMed 37796983