PB-CAG-ChR2-YFP
(Plasmid #204345)

• Purpose: PiggyBac transposon vector suitable for inserting the ChR2-YFP optogenetic actuator driven by the ubiquitous CAG promoter into the genome of mammalian cell lines.
• Depositing Lab: Ivo Lieberam
• Depositing Organization: King's College London
  Located in the United Kingdom of Great Britain and Northern Ireland
• Publication: Harley et al Cell Rep. 2023 Dec 26;42(12):113509. doi: 10.1016/j.celrep.2023.113509. Epub 2023 Nov 28.

Backbone

• Vector backbone: pXL-BacII
• Backbone manufacturer: Malcolm Fraser (see PMID: 17233894)
• Backbone size w/o insert (bp): 3400
• Total vector size (bp): 9200
• Modifications to backbone: A cassette consisting of the CAG promoter, the ChR2-YFP gene (PMID: 16116447), a bGH-poly-A site and a FRT-Hygro selection cassette was inserted between the ITR transposon sites.
• Vector type: Mammalian Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ChR2-YFP
• Species: Chlamydomonas reinhardtii
• Insert Size (bp): 1661
• Mutation: C-terminus (aa315-737) is deleted - PMID: 14615590; H134R mutation - PMID: 20203662
• GenBank ID: AF461397
• Promoter: CAG
• Tag / Fusion Protein:
  • Yellow fluorescent protein (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Age1 (not destroyed)
• 3′ cloning site: EcoR1 (destroyed during cloning)
• 5′ sequencing primer: GTGACCGGCGGCTCTAGCTAGA
• 3′ sequencing primer: GGCCACTTGTGTAGCGCCAAGT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Karl Deisseroth (MTA with King's College London).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
• Industry Terms:
  • Not Available to Industry

DNA (Catalog # 204345-D50)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 50 μg
• Concentration: 1 μg/μL
• Pricing: $495 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

DNA (Catalog # 204345-D100)

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

• Amount: 100 μg
• Concentration: 1 μg/μL
• Pricing: $585 USD
• Storage: 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • piggyBac Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.