PB-CAG-ChR2-YFP
(Plasmid
#204345)
-
PurposePiggyBac transposon vector suitable for inserting the ChR2-YFP optogenetic actuator driven by the ubiquitous CAG promoter into the genome of mammalian cell lines.
-
Depositing Lab
-
Depositing OrganizationKing's College London
Located in the United Kingdom of Great Britain and Northern Ireland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 204345 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 204345-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 204345-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepXL-BacII
-
Backbone manufacturerMalcolm Fraser (see PMID: 17233894)
- Backbone size w/o insert (bp) 3400
- Total vector size (bp) 9200
-
Modifications to backboneA cassette consisting of the CAG promoter, the ChR2-YFP gene (PMID: 16116447), a bGH-poly-A site and a FRT-Hygro selection cassette was inserted between the ITR transposon sites.
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameChR2-YFP
-
SpeciesChlamydomonas reinhardtii
-
Insert Size (bp)1661
-
MutationC-terminus (aa315-737) is deleted - PMID: 14615590; H134R mutation - PMID: 20203662
-
GenBank IDAF461397
- Promoter CAG
-
Tag
/ Fusion Protein
- Yellow fluorescent protein (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Age1 (not destroyed)
- 3′ cloning site EcoR1 (destroyed during cloning)
- 5′ sequencing primer GTGACCGGCGGCTCTAGCTAGA
- 3′ sequencing primer GGCCACTTGTGTAGCGCCAAGT
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byKarl Deisseroth (MTA with King's College London).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 204345-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 204345-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB-CAG-ChR2-YFP was a gift from Ivo Lieberam (Addgene plasmid # 204345 ; http://n2t.net/addgene:204345 ; RRID:Addgene_204345) -
For your References section:
Aberrant axon initial segment plasticity and intrinsic excitability of ALS hiPSC motor neurons. Harley P, Kerins C, Gatt A, Neves G, Riccio F, Machado CB, Cheesbrough A, R'Bibo L, Burrone J, Lieberam I. Cell Rep. 2023 Dec 26;42(12):113509. doi: 10.1016/j.celrep.2023.113509. Epub 2023 Nov 28. 10.1016/j.celrep.2023.113509 PubMed 38019651