-
PurposeVector for generating dsDNA donors for homology-directed repair. Contains the visible marker 3xP3-DsRed flanked by piggyBac termini.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 64703 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepJ204
-
Backbone manufacturerDNA2.0
- Backbone size w/o insert (bp) 2816
- Total vector size (bp) 4569
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepiggyBac-3xP3-DsRed
-
Alt namepBac-DsRed
-
Insert Size (bp)1692
- Promoter 3xP3
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TGATATCAAAATTATACATGTCAACG
- 3′ sequencing primer ACGAAAGGCTCAGTCGAAAG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byWe had it synthesized by DNA2.0
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pScarlessHD-DsRed was a gift from Kate O'Connor-Giles (Addgene plasmid # 64703 ; http://n2t.net/addgene:64703 ; RRID:Addgene_64703)