Skip to main content

pcDNA5-FRT/TO-mNeonGreen-NUT
(Plasmid #204693)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 204693 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 204693-D50 50 μg of DNA in Tris buffer $495
DNA 204693-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pcDNA5
  • Backbone manufacturer
    Thermo Fisher Scientific
  • Backbone size w/o insert (bp) 5160
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NUT
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    4146
  • Mutation
    n/a
  • Entrez Gene
    NUTM1 (a.k.a. C15orf55, FAM22H, NUT)
  • Promoter CMV
  • Tag / Fusion Protein
    • mNeonGreen (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer CCATAGAAGACACCGGGACCGATCC
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    purchased from Dharmacon

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

NLS, mNeonGreen / All our plasmids are pcDNA5-FRT/TO and are used in a co-transfection with Flp recombinase expression vector, pOG44.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA5-FRT/TO-mNeonGreen-NUT was a gift from Michael Rosen (Addgene plasmid # 204693 ; http://n2t.net/addgene:204693 ; RRID:Addgene_204693)
  • For your References section:

    Molecular features driving condensate formation and gene expression by the BRD4-NUT fusion oncoprotein are overlapping but distinct. Kosno M, Currie SL, Kumar A, Xing C, Rosen MK. Sci Rep. 2023 Jul 24;13(1):11907. doi: 10.1038/s41598-023-39102-9. 10.1038/s41598-023-39102-9 PubMed 37488172