pcDNA5-FRT/TO-mNeonGreen-BRD4-p300(I)
(Plasmid
#204700)
-
PurposeThis plasmid allows for inducible expression of engineered BRD4-p300(I) fusion tagged with mNeonGreen, in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 204700 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepcDNA5
-
Backbone manufacturerThermo Fisher Scientific
- Backbone size w/o insert (bp) 5160
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBRD4-p300(I)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)6924
-
Mutationdeletion of all TF-bidning domains and HAT in p300
-
Entrez GeneBRD4 (a.k.a. CAP, CDLS6, FSHRG4, HUNK1, HUNKI, MCAP)
-
Entrez GeneEP300 (a.k.a. KAT3B, MKHK2, RSTS2, p300)
- Promoter CMV
-
Tag
/ Fusion Protein
- mNeonGreen (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer CCATAGAAGACACCGGGACCGATCC
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
NLS, mNeonGreen, other inserts are a fusion of two genes / All our plasmids are pcDNA5-FRT/TO and are used in a co-transfection with Flp recombinase expression vector, pOG44.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA5-FRT/TO-mNeonGreen-BRD4-p300(I) was a gift from Michael Rosen (Addgene plasmid # 204700 ; http://n2t.net/addgene:204700 ; RRID:Addgene_204700) -
For your References section:
Molecular features driving condensate formation and gene expression by the BRD4-NUT fusion oncoprotein are overlapping but distinct. Kosno M, Currie SL, Kumar A, Xing C, Rosen MK. Sci Rep. 2023 Jul 24;13(1):11907. doi: 10.1038/s41598-023-39102-9. 10.1038/s41598-023-39102-9 PubMed 37488172