Skip to main content
Addgene
Open Menu

Integrin β4-GFP
(Plasmid #205092)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 205092 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 205092-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 205092-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone size w/o insert (bp) 4731
  • Total vector size (bp) 10130
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Integrin beta 4
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    5445
  • Entrez Gene
    ITGB4 (a.k.a. CD104, GP150, JEB5A, JEB5B)
  • Tag / Fusion Protein
    • GFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer gatccgctagcgtttaaacgggccctctagac
  • 3′ sequencing primer ccgcggtaccgaagtttggaagaactgttggtcc
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The DNA fragment encoding integrin beta 4 was amplified from pcDNA3.1/Myc-His beta4, a gift from Filippo Giancotti (Addgene plasmid # 16039).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Integrin β4-GFP was a gift from Bianxiao Cui (Addgene plasmid # 205092 ; http://n2t.net/addgene:205092 ; RRID:Addgene_205092)

  • For your References section:

    Curved adhesions mediate cell attachment to soft matrix fibres in three dimensions. Zhang W, Lu CH, Nakamoto ML, Tsai CT, Roy AR, Lee CE, Yang Y, Jahed Z, Li X, Cui B. Nat Cell Biol. 2023 Sep 28. doi: 10.1038/s41556-023-01238-1. 10.1038/s41556-023-01238-1 PubMed 37770566
Related items:
Commonly requested with: