Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed November 28th & 29th for the Thanksgiving holiday. Order processing and shipping may be delayed the week of November 25th - 29th. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pEGFP Kindlin2
(Plasmid #105305)


Item Catalog # Description Quantity Price (USD)
Plasmid 105305 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    modified pEGFP-N1. GFP is in BamH1 and Not 1 sites
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • GenBank ID
  • Entrez Gene
    FERMT2 (a.k.a. KIND2, MIG2, PLEKHC1, UNC112, UNC112B, mig-2)
  • Tag / Fusion Protein
    • EGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Nhe1 (unknown if destroyed)
  • 3′ cloning site BamH1 (unknown if destroyed)
  • 5′ sequencing primer AATGTCGTAACAACTCCGCCCC
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Original Kindlin 2 (FERMT2) cDNA was from OriGene, Cat no. SC320413.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP Kindlin2 was a gift from Kenneth Yamada (Addgene plasmid # 105305 ; ; RRID:Addgene_105305)