Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We have implemented updates to our Transparency and Privacy Policy.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #50515)


Item Catalog # Description Quantity Price (USD)
Plasmid 50515 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Yamada Lab, Tamura et al., Science 280: 1614-7 (1998)
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
    protein tyrosine kinase
  • Alt name
  • Alt name
  • Species
    M. musculus (mouse)
  • Promoter CMV
  • Tag / Fusion Protein
    • GFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer GFP FW (AAAGACCCCAACGAGAAGCG)
  • 3′ sequencing primer GFP ASO (TTGTAACCATTATAAGCTGC)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Fluorophore encoded by this plasmid is ABB59962.1 with G66A.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGFP FAK was a gift from Kenneth Yamada (Addgene plasmid # 50515 ; ; RRID:Addgene_50515)
  • For your References section:

    Shc and FAK differentially regulate cell motility and directionality modulated by PTEN. Gu J, Tamura M, Pankov R, Danen EH, Takino T, Matsumoto K, Yamada KM. J Cell Biol. 1999 Jul 26;146(2):389-403. 10.1083/jcb.146.2.389 PubMed 10427092