pCDNA HA FAK Y925F
(Plasmid
#50509)
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 50509 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCDNA HA
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameprotein tyrosine kinase, mutated
-
Alt nameFAK
-
Alt namePTK2
-
SpeciesM. musculus (mouse)
-
MutationY925F
- Promoter CMV
-
Tag
/ Fusion Protein
- HA (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer pCDNA FW (TTAATACGACTCACTATAGGG) (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
HA tag variant: TMYDVPDYA
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDNA HA FAK Y925F was a gift from Kenneth Yamada (Addgene plasmid # 50509 ; http://n2t.net/addgene:50509 ; RRID:Addgene_50509) -
For your References section:
PTEN interactions with focal adhesion kinase and suppression of the extracellular matrix-dependent phosphatidylinositol 3-kinase/Akt cell survival pathway. Tamura M, Gu J, Danen EH, Takino T, Miyamoto S, Yamada KM. J Biol Chem. 1999 Jul 16;274(29):20693-703. 10.1074/jbc.274.29.20693 PubMed 10400703