pET-21(+)Tm9D8* TrpB
(Plasmid
#207517)
-
PurposeExpression of Tm9D8* TrpB for the synthesis of 7-Aza-L-Tryptophan (7AW) from 7-Azaindole (7AI) and serine
-
Depositing Lab
-
Depositing OrganizationAustralian National University
Located in Australia -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 207517 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepET-21(+)
- Backbone size w/o insert (bp) 5378
- Total vector size (bp) 6566
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTryptophan synthase β-subunit
-
Alt nameTm9D8* TrpB
-
SpeciesThermotoga maritima
-
Insert Size (bp)1188
- Promoter T7
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET-21(+)Tm9D8* TrpB was a gift from Thomas Huber (Addgene plasmid # 207517 ; http://n2t.net/addgene:207517 ; RRID:Addgene_207517) -
For your References section:
Genetic Encoding of 7-Aza-l-tryptophan: Isoelectronic Substitution of a Single CH-Group in a Protein for a Nitrogen Atom for Site-Selective Isotope Labeling. Abdelkader EH, Qianzhu H, Huber T, Otting G. ACS Sens. 2023 Oct 27. doi: 10.1021/acssensors.3c01904. 10.1021/acssensors.3c01904 PubMed 37890165