bSLS.114
(Bacterial strain #191530)

• Purpose: contains a knockout gene in the E. coli strain BL21-AI
• Depositing Lab: Seth Shipman
• Publication: Lopez et al Nat Chem Biol. 2022 Feb;18(2):199-206. doi: 10.1038/s41589-021-00927-y. Epub 2021 Dec 23.

Backbone

• Vector backbone: n/a
• Vector type: This is a strain, not a plasmid

Growth in Bacteria

• Bacterial Resistance(s): None
• Growth Temperature: 37°C
• Growth Strain(s): bSLS.114
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: E. coli B F– ompT gal dcm lon hsdSB(rB–mB–) [malB+]K-12(λS) araB::T7RNAP-tetA Δretron-Eco1
• Species: E.coli

Cloning Information

• Cloning method: Unknown

Resource Information

• Supplemental Documents:
  • bSLS114_gel.pdf
  • bSLS114_sequence.fasta
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Derived from BL21(AI), grow in LB in BSL1 laboratory conditions

Genotype: E. coli B F– ompT gal dcm lon hsdSB(rB–mB–) [malB+]K-12(λS) araB::T7RNAP-tetA Δretron-Eco1

Genotyping primers: CATGTGCATGAAAACCACTGC / CTGGTTGGACGAAGAAGTGC (273 base amplicon)