Skip to main content

pSEVA43-GG
(Plasmid #208014)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 208014 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 208014-D50 50 μg of DNA in Tris buffer $495
DNA 208014-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pSEVA231
  • Backbone manufacturer
    SEVA collection
  • Backbone size w/o insert (bp) 3182
  • Total vector size (bp) 4054

Growth in Bacteria

  • Bacterial Resistance(s)
    Streptomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    msfGFP
  • Insert Size (bp)
    717
  • Promoter 14G

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer agcggataacaatttcacacagga
  • 3′ sequencing primer cgccagggttttcccagtcacgac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2023.06.29.547033 for bioRxiv preprint.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSEVA43-GG was a gift from Pablo Ivan Nikel (Addgene plasmid # 208014 ; http://n2t.net/addgene:208014 ; RRID:Addgene_208014)
  • For your References section:

    A SEVA-based, CRISPR-Cas3-assisted genome engineering approach for Pseudomonas with efficient vector curing. Lammens E-M, Volke DC, Schroven K, Voet M, Kerremans A, Lavigne R, Hendrix H. Microbiol Spectr. 2023 Nov 17:e0270723. doi: 10.1128/spectrum.02707-23. 10.1128/spectrum.02707-23 PubMed 37975669