-
PurposeExpression of enAsCas12f-HKRA and sgRNA_v7 in mammalian cells
-
Depositing Lab
-
Depositing OrganizationKyoto Prefectural University of Medicine
Located in Japan -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 208357 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 208357-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 208357-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCMV-AsCas12f1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameenAsCas12f-HKRA
-
Alt nameCas12U3
-
SpeciesSynthetic
-
MutationI123H/D195K/D208R/V232A
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer GCGATGCAATTTCCTCATTT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 208357-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 208357-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV enAsCas12f-HKRA-sgRNA_v7 was a gift from Atsushi Hoshino (Addgene plasmid # 208357 ; http://n2t.net/addgene:208357 ; RRID:Addgene_208357) -
For your References section:
An AsCas12f-based compact genome-editing tool derived by deep mutational scanning and structural analysis. Hino T, Omura SN, Nakagawa R, Togashi T, Takeda SN, Hiramoto T, Tasaka S, Hirano H, Tokuyama T, Uosaki H, Ishiguro S, Kagieva M, Yamano H, Ozaki Y, Motooka D, Mori H, Kirita Y, Kise Y, Itoh Y, Matoba S, Aburatani H, Yachie N, Karvelis T, Siksnys V, Ohmori T, Hoshino A, Nureki O. Cell. 2023 Sep 22:S0092-8674(23)00963-7. doi: 10.1016/j.cell.2023.08.031. 10.1016/j.cell.2023.08.031 PubMed 37776859