CRY2clust-mCherry-RANK-P2A-CIBNcaax
(Plasmid
#208613)
-
PurposeMammalian expression of CRY2clust-mCherry-RANK-P2A-CIBNcaax (Opto-RANKm)
-
Depositing Labs
-
Depositing OrganizationInstitute of Science Tokyo
Located in Japan -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 208613 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 208613-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 208613-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepCAG-WPRE/N1 (modified pEGFP-N1)
-
Backbone manufacturerModified from Clontech
- Backbone size w/o insert (bp) 5731
- Total vector size (bp) 10486
-
Modifications to backboneCMV promoter was replaced by CAG promoter, the woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) was inserted, and EGFP was removed.
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCRY2clust-mCherry-RANK-P2A-CIBNcaax
-
Alt nameOpto-RANKm
-
SpeciesM. musculus (mouse), A. thaliana (mustard weed)
-
Insert Size (bp)4755
-
Entrez GeneCry2 (a.k.a. D130054K12Rik)
- Promoter CAG
-
Tags
/ Fusion Proteins
- mCherry
- CAAX (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer GCAACGTGCTGGTTATTGTG
- 3′ sequencing primer GCGTAAAAGGAGCAACATAG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDr. Won Do Heo (CRY2clust from mCherry-CRY2clust, Addgene ID 105624 ): One silent mutation at a KpnI site is introduced. Dr. Kai Zhang (P2A-CIBN-CIBN from OptoRaf, Addgene ID 207163): One silent mutation at an XhoI site is introduced.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 208613-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 208613-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CRY2clust-mCherry-RANK-P2A-CIBNcaax was a gift from Tomohiro Ishii & Takao Nakata (Addgene plasmid # 208613 ; http://n2t.net/addgene:208613 ; RRID:Addgene_208613) -
For your References section:
Development of an optogenetics tool, Opto-RANK, for control of osteoclast differentiation using blue light. Takada A, Asano T, Nakahama KI, Ono T, Nakata T, Ishii T. Sci Rep. 2024 Jan 19;14(1):1749. doi: 10.1038/s41598-024-52056-w. 10.1038/s41598-024-52056-w PubMed 38242937