CRY2clust-mCherry-RANK
(Plasmid
#208612)
-
PurposeMammalian expression of CRY2clust-mCherry-RANK (Opto-RANKc)
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 208612 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCAG-WPRE/N1 (modified pEGFP-N1)
-
Backbone manufacturerModified from Clontech
- Backbone size w/o insert (bp) 5731
- Total vector size (bp) 10486
-
Modifications to backboneCMV promoter was replaced by CAG promoter, the woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) was inserted, and EGFP was removed.
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCRY2clust-mCherry-RANK
-
Alt nameOpto-RANKc
-
SpeciesM. musculus (mouse), A. thaliana (mustard weed)
-
Insert Size (bp)3510
-
Entrez GeneCry2 (a.k.a. D130054K12Rik)
- Promoter CAG
-
Tag
/ Fusion Protein
- mCherry
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GCAACGTGCTGGTTATTGTG
- 3′ sequencing primer GCGTAAAAGGAGCAACATAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDr. Won Do Heo (CRY2clust from mCherry-CRY2clust, Addgene ID 105624 ): One silent mutation at a KpnI site is introduced.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CRY2clust-mCherry-RANK was a gift from Tomohiro Ishii & Takao Nakata (Addgene plasmid # 208612 ; http://n2t.net/addgene:208612 ; RRID:Addgene_208612) -
For your References section:
Development of an optogenetics tool, Opto-RANK, for control of osteoclast differentiation using blue light. Takada A, Asano T, Nakahama KI, Ono T, Nakata T, Ishii T. Sci Rep. 2024 Jan 19;14(1):1749. doi: 10.1038/s41598-024-52056-w. 10.1038/s41598-024-52056-w PubMed 38242937