pDisplay-GRAB_CRFmut
(Plasmid
#208656)
-
PurposeExpresses the genetically-encoded fluorescent corticotropin-releasing factor (CRF) contorl sensor GRAB_CRFmut in mammalian cells
-
Depositing Lab
-
Depositing OrganizationPeking University
Located in China -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 208656 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepDisplay
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 6546
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGPCR activation based corticotropin-releasing factor (CRF) contorl sensor GRAB_CRFmut
-
Alt nameGRAB_CRFmut
-
Alt nameCRFmut
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2124
- Promoter CMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGGGCGGTAGGCGTGTA
- 3′ sequencing primer CCTCACATTGCCAAAAGACG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2022.03.26.485911v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDisplay-GRAB_CRFmut was a gift from Yulong Li (Addgene plasmid # 208656 ; http://n2t.net/addgene:208656 ; RRID:Addgene_208656) -
For your References section:
A tool kit of highly selective and sensitive genetically encoded neuropeptide sensors. Wang H, Qian T, Zhao Y, Zhuo Y, Wu C, Osakada T, Chen P, Chen Z, Ren H, Yan Y, Geng L, Fu S, Mei L, Li G, Wu L, Jiang Y, Qian W, Zhang L, Peng W, Xu M, Hu J, Jiang M, Chen L, Tang C, Zhu Y, Lin D, Zhou JN, Li Y. Science. 2023 Nov 17;382(6672):eabq8173. doi: 10.1126/science.abq8173. Epub 2023 Nov 17. 10.1126/science.abq8173 PubMed 37972184