-
Depositing Lab
-
Depositing OrganizationScripps California (The Scripps Research Institute)
Located in United States of America -
Publication
-
Citations
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 21050 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepBR322
- Backbone size w/o insert (bp) 11689
-
Vector typeBacterial Expression, Retroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRas-homolog enriched in brain
-
Alt nameRheb
-
SpeciesH. sapiens (human)
-
Insert Size (bp)685
-
Mutationglutamine 64 to leucine
-
GenBank IDAF493921
-
Entrez GeneRHEB (a.k.a. RHEB2)
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SfiI(A) (not destroyed)
- 3′ cloning site SfiI(B) (not destroyed)
- 5′ sequencing primer AGCTCCGCGGGCCACCATGGACTACAAGGATGACGATGACAAGGCGGCCGCGCCGCAGTCCAAG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The creation of RCAS(B)-SfiI and the adapter plasmid pBSFI was described in Aoki et al., PNAS. 1998 Dec 8;95(25):14950-5. The SacII/XbaI fragment was cloned into pBSFI and the Sfi fragment was further cloned into RCAS(B)-SfiI.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
RCAS(B)-Rheb-Q64L was a gift from Peter Vogt (Addgene plasmid # 21050 ; http://n2t.net/addgene:21050 ; RRID:Addgene_21050) -
For your References section:
Constitutively active Rheb induces oncogenic transformation. Jiang H, Vogt PK. Oncogene. 2008 Sep 25. 27(43):5729-40. 10.1038/onc.2008.180 PubMed 18521078
Map uploaded by the depositor.