-
Depositing Lab
-
Depositing OrganizationUniversity of California, Los Angeles (UCLA)
Located in United States of America -
Citations
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 17967 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepMXs
- Backbone size w/o insert (bp) 4622
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersnone
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKruppel-like factor 4 (gut)
-
Alt nameKLF4
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1413
-
MutationN/A
-
Entrez GeneKLF4 (a.k.a. EZF, GKLF)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site Not I (not destroyed)
- 5′ sequencing primer cctctagactgccggatctagcta
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypMXs is from Dr. Toshio Kitamura of the University of Tokyo, the Institute of Medical Science. If you use this plasmid in a paper, please cite: Retrovirus-mediated gene transfer and expression cloning: powerful tools in functional genomics. Exp Hematol. 2003 Nov;31(11):1007-14. Kitamura T, Koshino Y, Shibata F, Oki T, Nakajima H, Nosaka T, Kumagai H.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMXs-hKLF4 (Plath) was a gift from Kathrin Plath (Addgene plasmid # 17967 ; http://n2t.net/addgene:17967 ; RRID:Addgene_17967) -
For your References section:
Generation of human induced pluripotent stem cells from dermal fibroblasts. Lowry WE, Richter L, Yachechko R, Pyle AD, Tchieu J, Sridharan R, Clark AT, Plath K. Proc Natl Acad Sci U S A. 2008 Feb 26. 105(8):2883-8. 10.1073/pnas.0711983105 PubMed 18287077
Map uploaded by the depositor.