Skip to main content

pSLQ5135: pCAG-BFP-GuideArray
(Plasmid #210606)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 210606 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 210606-D50 50 μg of DNA in Tris buffer $495
DNA 210606-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pUC19
  • Backbone size w/o insert (bp) 2727
  • Total vector size (bp) 5435
  • Vector type
    CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    pCAG-BFP-GuideArray
  • Alt name
    five guides targeting four genes: IL18, IL7, IFNg, and IL2
  • Insert Size (bp)
    2708
  • Promoter CAG

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer gtaaaacgacggccagt
  • 3′ sequencing primer gatgagtttggacaaaccac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSLQ5135: pCAG-BFP-GuideArray was a gift from Stanley Qi (Addgene plasmid # 210606 ; http://n2t.net/addgene:210606 ; RRID:Addgene_210606)
  • For your References section:

    Sonogenetic control of multiplexed genome regulation and base editing. Liu P, Foiret J, Situ Y, Zhang N, Kare AJ, Wu B, Raie MN, Ferrara KW, Qi LS. Nat Commun. 2023 Oct 18;14(1):6575. doi: 10.1038/s41467-023-42249-8. 10.1038/s41467-023-42249-8 PubMed 37852951