AAV-AIO-M11-gRNA-EFS-NMS-SadCas9
(Plasmid
#210710)
-
PurposeThis Plasmid express M11 promoter driven SadCas9 specific gRNA and EFS promoter driven NMS transactivation module fused to SadCas9
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 210710 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepAAV
-
Vector typeMammalian Expression, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameSadCas9 specific gRNA and NMS fused to N-terminus of SadCas9
-
SpeciesH. sapiens (human), Synthetic; Staphylococcus aureus
-
Insert Size (bp)4140
-
MutationD10A/N580A
-
GenBank IDNM_001282660.2 NM_001384880.1
-
Entrez GeneSTAT1 (a.k.a. CANDF7, IMD31A, IMD31B, IMD31C, ISGF-3, STAT91)
-
Entrez GeneMRTFA (a.k.a. BSAC, MAL, MKL, MKL1, MRTF-A)
- Promoter M11
-
Tag
/ Fusion Protein
- FLAG (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATATTTAGCATGTCGCTATGTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Stbl3 is also a suitable growth strain.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-AIO-M11-gRNA-EFS-NMS-SadCas9 was a gift from Isaac Hilton (Addgene plasmid # 210710 ; http://n2t.net/addgene:210710 ; RRID:Addgene_210710) -
For your References section:
Compact engineered human mechanosensitive transactivation modules enable potent and versatile synthetic transcriptional control. Mahata B, Cabrera A, Brenner DA, Guerra-Resendez RS, Li J, Goell J, Wang K, Guo Y, Escobar M, Parthasarathy AK, Szadowski H, Bedford G, Reed DR, Kim S, Hilton IB. Nat Methods. 2023 Oct 9. doi: 10.1038/s41592-023-02036-1. 10.1038/s41592-023-02036-1 PubMed 37813990