Skip to main content

pCAG-CHMP1B-FOS
(Plasmid #211825)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 211825 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pGAC-MCS2-FOS
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CHMP1B
  • Alt name
    CHMP1.5
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_020412.5 57132
  • Entrez Gene
    CHMP1B (a.k.a. C10orf2, C18-ORF2, C18orf2, CHMP1.5, Vps46-2, Vps46B, hVps46-2)
  • Promoter CAG
  • Tag / Fusion Protein
    • FOS (Flag-One-Strep) (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Kpn1 (unknown if destroyed)
  • 3′ cloning site Xho1 (unknown if destroyed)
  • 5′ sequencing primer TCGGCTTCTGGCGTGTGACC
  • 3′ sequencing primer TGTCCCCATAATTTTTGGCAGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-CHMP1B-FOS was a gift from Wesley Sundquist (Addgene plasmid # 211825 ; http://n2t.net/addgene:211825 ; RRID:Addgene_211825)
  • For your References section:

    ESCRT-III assembles around mis-segregated DNA to protect genome stability. Glover J, Talledge N, McCullough J, Alian A, Sadler JBA, Kamboj S, Dempsey NWM, Laughlin TG, Nguyen HC, Wenzel DM, Lalonde MS, Paine EL, Ganser-Pornillos B, Ventimiglia LN, LaJoie D, Iwasa JH, Arthur CP, Lee DJ, Moss FR 3rd, Venkatesh M, Arnold LM, Johnson JS, Ullman KS, Frost A, Sundquist WI, Martin-Serrano J. Nat Struct Mol Biol. 2026 Jul 15. doi: 10.1038/s41594-026-01841-4. 10.1038/s41594-026-01841-4 PubMed 42458110