pCAG-CHMP1B-FOS
(Plasmid
#211825)
-
PurposeExpresses CHMP1B with a C-terminal FOS (Flag-One-Strep) tag in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 211825 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepGAC-MCS2-FOS
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCHMP1B
-
Alt nameCHMP1.5
-
SpeciesH. sapiens (human)
-
GenBank IDNM_020412.5 57132
-
Entrez GeneCHMP1B (a.k.a. C10orf2, C18-ORF2, C18orf2, CHMP1.5, Vps46-2, Vps46B, hVps46-2)
- Promoter CAG
-
Tag
/ Fusion Protein
- FOS (Flag-One-Strep) (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Kpn1 (unknown if destroyed)
- 3′ cloning site Xho1 (unknown if destroyed)
- 5′ sequencing primer TCGGCTTCTGGCGTGTGACC
- 3′ sequencing primer TGTCCCCATAATTTTTGGCAGAGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-CHMP1B-FOS was a gift from Wesley Sundquist (Addgene plasmid # 211825 ; http://n2t.net/addgene:211825 ; RRID:Addgene_211825) -
For your References section:
ESCRT-III assembles around mis-segregated DNA to protect genome stability. Glover J, Talledge N, McCullough J, Alian A, Sadler JBA, Kamboj S, Dempsey NWM, Laughlin TG, Nguyen HC, Wenzel DM, Lalonde MS, Paine EL, Ganser-Pornillos B, Ventimiglia LN, LaJoie D, Iwasa JH, Arthur CP, Lee DJ, Moss FR 3rd, Venkatesh M, Arnold LM, Johnson JS, Ullman KS, Frost A, Sundquist WI, Martin-Serrano J. Nat Struct Mol Biol. 2026 Jul 15. doi: 10.1038/s41594-026-01841-4. 10.1038/s41594-026-01841-4 PubMed 42458110