Talin1-mCherry
(Plasmid
#212004)
-
PurposeExpression of mouse full-length (1-2541) talin1-mCherry in mammalian cells
-
Depositing Lab
-
Depositing OrganizationTampere University, BioMediTech
Located in Finland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 212004 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 212004-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 212004-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4002
- Total vector size (bp) 12336
-
Modifications to backboneN-terminal EGFP removed
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMouse talin1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)8334
-
GenBank IDCAA39588.1
-
Entrez GeneTln1 (a.k.a. Tln)
- Promoter CMV
-
Tag
/ Fusion Protein
- mCherry fluorescent protein (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer acgcaaatgggcggtagg
- 3′ sequencing primer GATGAGTTTGGACAAACCAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 212004-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 212004-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Talin1-mCherry was a gift from Vesa Hytönen (Addgene plasmid # 212004 ; http://n2t.net/addgene:212004 ; RRID:Addgene_212004) -
For your References section:
Talin-mediated force transmission and talin rod domain unfolding independently regulate adhesion signaling. Rahikainen R, Ohman T, Turkki P, Varjosalo M, Hytonen VP. J Cell Sci. 2019 Apr 3;132(7):jcs226514. doi: 10.1242/jcs.226514. 10.1242/jcs.226514 PubMed 30837291