Skip to main content

pBOBI TP53 S46D
(Plasmid #213002)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 213002 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 213002-D50 50 μg of DNA in Tris buffer $495
DNA 213002-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pBOBI
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    P53
  • Alt name
    TP53
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1182
  • Mutation
    S46D
  • Entrez Gene
    TP53 (a.k.a. BCC7, BMFS5, LFS1, P53, TRP53)
  • Promoter cmv

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer PLNCX-F
  • 3′ sequencing primer TACTCACCCCAACAGCTGGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBOBI TP53 S46D was a gift from Sheng-cai Lin (Addgene plasmid # 213002 ; http://n2t.net/addgene:213002 ; RRID:Addgene_213002)
  • For your References section:

    Low glucose metabolite 3-phosphoglycerate switches PHGDH from serine synthesis to p53 activation to control cell fate. Wu YQ, Zhang CS, Xiong J, Cai DQ, Wang CZ, Wang Y, Liu YH, Wang Y, Li Y, Wu J, Wu J, Lan B, Wang X, Chen S, Cao X, Wei X, Hu HH, Guo H, Yu Y, Ghafoor A, Xie C, Wu Y, Xu Z, Zhang C, Zhu M, Huang X, Sun X, Lin SY, Piao HL, Zhou J, Lin SC. Cell Res. 2023 Nov;33(11):835-850. doi: 10.1038/s41422-023-00874-4. Epub 2023 Sep 19. 10.1038/s41422-023-00874-4 PubMed 37726403