Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pcDNA3 GFP LIC cloning vector (6D)
(Plasmid #30127)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 30127 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3
  • Backbone size (bp) 6145
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    None
  • Tag / Fusion Protein
    • GFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site LIC site vKoz/GFP (destroyed during cloning)
  • 3′ cloning site LIC site vKoz/GFP (destroyed during cloning)
  • 5′ sequencing primer CMV F (5'cgcaaatgggcggtaggcgtg)
  • 3′ sequencing primer GFP reverse (5'cagctcgaccaggatgggc3')
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This is an empty LIC vector derived from pcDNA3. It adds a GFP gene to the C-terminus of your protein of interest.

GFP has a excitation max of 489 nm and an emission max of 510 nm.

To clone into this vector, add the following tags to your PCR primers:

LIC vKoz Forward tag 5’-TACTTCCAATCCAATGCCACC(ATG)

LIC vGFP Reverse tag 5’-CTCCCACTACCAATGCC

Do NOT include a stop codon with your reverse primer.

T4-treat PCR with dCTP. Linearize vector with SspI, then T4-treat with dGTP. Can verify the presence of insert by digesting with HindIII and XbaI.

For more information, please see our website:
http://qb3.berkeley.edu/qb3/macrolab/

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3 GFP LIC cloning vector (6D) was a gift from Scott Gradia (Addgene plasmid # 30127 ; http://n2t.net/addgene:30127 ; RRID:Addgene_30127)