Skip to main content

pSBbi-GP-TFIIB(D207A)-2xStrep
(Plasmid #213920)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 213920 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pSBbi-GP modified to remove GFP
  • Backbone manufacturer
    Addgene #60511 without GFP
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TFIIB(D207A)-2xStrep
  • Alt name
    GTF2B(D207A)-2xStrep
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1062
  • Mutation
    (1) D207A (2) Coding region changed for resistance to Dharmacon Accell and OnTarget GTF2B siRNA pools
  • Entrez Gene
    GTF2B (a.k.a. TF2B, TFIIB)
  • Promoter EF-1EF1a/RPBSA
  • Tag / Fusion Protein
    • 2xStrep (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer ttcaaagtttttttcttccatttaagg
  • 3′ sequencing primer ggcaactagaaggcacagt
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2024.01.16.575933 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSBbi-GP-TFIIB(D207A)-2xStrep was a gift from Britt Glaunsinger (Addgene plasmid # 213920 ; http://n2t.net/addgene:213920 ; RRID:Addgene_213920)
  • For your References section:

    Cleavage of the RNA polymerase II general transcription factor TFIIB tunes transcription during stress. Gulyas L, Lari A, Shah SB, Glaunsinger BA. Genes Dev. 2026 May 13. doi: 10.1101/gad.353187.125. 10.1101/gad.353187.125 PubMed 42128667