pSBbi-GP-TFIIB(S65E)-2xStrep
(Plasmid
#213922)
-
PurposeSleeping beauty vector for expression of C-terminally strep-tagged TFIIB(S65E)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 213922 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepSBbi-GP modified to remove GFP
-
Backbone manufacturerAddgene #60511 without GFP
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTFIIB(S65E)-2xStrep
-
Alt nameGTF2B(S65E)-2xStrep
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1062
-
Mutation(1) S65E (2) Coding region changed for resistance to Dharmacon Accell and OnTarget GTF2B siRNA pools
-
Entrez GeneGTF2B (a.k.a. TF2B, TFIIB)
- Promoter EF-1EF1a/RPBSA
-
Tag
/ Fusion Protein
- 2xStrep (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ttcaaagtttttttcttccatttaagg
- 3′ sequencing primer ggcaactagaaggcacagt
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.01.16.575933 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSBbi-GP-TFIIB(S65E)-2xStrep was a gift from Britt Glaunsinger (Addgene plasmid # 213922 ; http://n2t.net/addgene:213922 ; RRID:Addgene_213922) -
For your References section:
Cleavage of the RNA polymerase II general transcription factor TFIIB tunes transcription during stress. Gulyas L, Lari A, Shah SB, Glaunsinger BA. Genes Dev. 2026 May 13. doi: 10.1101/gad.353187.125. 10.1101/gad.353187.125 PubMed 42128667