Skip to main content

pLJM1-blast-Halo
(Plasmid #213923)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 213923 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pLJM1 modified to remove GFP and replace puromycin resistance with blasticidin resistance
  • Backbone manufacturer
    Addgene #19319 without GFP and with blasticidin resistance replacing puromycin resistance
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HaloTag
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    894
  • Promoter CMV/hPGK

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer ggatctctgctgtccctgtaataaacc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2024.01.16.575933 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLJM1-blast-Halo was a gift from Britt Glaunsinger (Addgene plasmid # 213923 ; http://n2t.net/addgene:213923 ; RRID:Addgene_213923)
  • For your References section:

    Cleavage of the RNA polymerase II general transcription factor TFIIB tunes transcription during stress. Gulyas L, Lari A, Shah SB, Glaunsinger BA. Genes Dev. 2026 May 13. doi: 10.1101/gad.353187.125. 10.1101/gad.353187.125 PubMed 42128667