pLJM1-blast-Halo
(Plasmid
#213923)
-
PurposeLentivector for expression of HaloTag protein
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 213923 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLJM1 modified to remove GFP and replace puromycin resistance with blasticidin resistance
-
Backbone manufacturerAddgene #19319 without GFP and with blasticidin resistance replacing puromycin resistance
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHaloTag
-
SpeciesH. sapiens (human)
-
Insert Size (bp)894
- Promoter CMV/hPGK
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer ggatctctgctgtccctgtaataaacc
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.01.16.575933 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLJM1-blast-Halo was a gift from Britt Glaunsinger (Addgene plasmid # 213923 ; http://n2t.net/addgene:213923 ; RRID:Addgene_213923) -
For your References section:
Cleavage of the RNA polymerase II general transcription factor TFIIB tunes transcription during stress. Gulyas L, Lari A, Shah SB, Glaunsinger BA. Genes Dev. 2026 May 13. doi: 10.1101/gad.353187.125. 10.1101/gad.353187.125 PubMed 42128667