modRNAc1 2x k-turn Cre
(Plasmid
#213975)
-
PurposeCre recombinase gene in modRNA cap1 vector
-
Depositing Lab
-
Depositing OrganizationPurdue University
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 213975 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonemodRNAc1
-
Backbone manufacturerAddgene #186158
- Backbone size w/o insert (bp) 3260
- Total vector size (bp) 4331
-
Vector typeMammalian Expression, Cre/Lox, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCre recombinase
-
SpeciesSynthetic
-
Insert Size (bp)1029
-
Tag
/ Fusion Protein
- SV40 NLS (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer CGACGTCacatttgcttctg
- 3′ sequencing primer TGTGGAATTGTGAGCGGATA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
modRNAc1 2x k-turn Cre was a gift from Xiaoping Bao (Addgene plasmid # 213975 ; http://n2t.net/addgene:213975 ; RRID:Addgene_213975) -
For your References section:
CAR-neutrophils produced in vivo to treat glioma. Chang Y, Shao K, Li H, Jin G, Bentley RT, McCain RR, Crain CJ, Shen J, Tan Y, Liang PY, Harper HA, Torregrosa-Allen S, Elzey BD, Vanhaezebrouck IF, Cohen-Gadol AA, Dong C, Zhu Y, Wang Y, Luo J, Lian XL, Bao X. Nat Biomed Eng. 2026 Apr 24:10.1038/s41551-026-01656-0. doi: 10.1038/s41551-026-01656-0. 10.1038/s41551-026-01656-0 PubMed 42032037