Skip to main content

modRNAc1 L7Ae miR142-miR223
(Plasmid #213977)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 213977 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    modRNAc1
  • Backbone manufacturer
    Addgene #186158
  • Backbone size w/o insert (bp) 3222
  • Total vector size (bp) 3582
  • Vector type
    Mammalian Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    L7Ae
  • Species
    Synthetic
  • Insert Size (bp)
    360

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer CGACGTCacatttgcttctg
  • 3′ sequencing primer TGTGGAATTGTGAGCGGATA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    modRNAc1 L7Ae miR142-miR223 was a gift from Xiaoping Bao (Addgene plasmid # 213977 ; http://n2t.net/addgene:213977 ; RRID:Addgene_213977)
  • For your References section:

    CAR-neutrophils produced in vivo to treat glioma. Chang Y, Shao K, Li H, Jin G, Bentley RT, McCain RR, Crain CJ, Shen J, Tan Y, Liang PY, Harper HA, Torregrosa-Allen S, Elzey BD, Vanhaezebrouck IF, Cohen-Gadol AA, Dong C, Zhu Y, Wang Y, Luo J, Lian XL, Bao X. Nat Biomed Eng. 2026 Apr 24:10.1038/s41551-026-01656-0. doi: 10.1038/s41551-026-01656-0. 10.1038/s41551-026-01656-0 PubMed 42032037