Skip to main content

modRNAc1 2x k-turn CLTX msCD28-CD3z CAR
(Plasmid #213984)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 213984 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    modRNAc1
  • Backbone manufacturer
    Addgene #213975
  • Backbone size w/o insert (bp) 3273
  • Total vector size (bp) 4680
  • Vector type
    Mammalian Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CLTC CAR
  • Species
    H. sapiens (human), M. musculus (mouse), Synthetic
  • Insert Size (bp)
    1407

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer CGACGTCacatttgcttctg
  • 3′ sequencing primer TGTGGAATTGTGAGCGGATA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    modRNAc1 2x k-turn CLTX msCD28-CD3z CAR was a gift from Xiaoping Bao (Addgene plasmid # 213984 ; http://n2t.net/addgene:213984 ; RRID:Addgene_213984)
  • For your References section:

    CAR-neutrophils produced in vivo to treat glioma. Chang Y, Shao K, Li H, Jin G, Bentley RT, McCain RR, Crain CJ, Shen J, Tan Y, Liang PY, Harper HA, Torregrosa-Allen S, Elzey BD, Vanhaezebrouck IF, Cohen-Gadol AA, Dong C, Zhu Y, Wang Y, Luo J, Lian XL, Bao X. Nat Biomed Eng. 2026 Apr 24:10.1038/s41551-026-01656-0. doi: 10.1038/s41551-026-01656-0. 10.1038/s41551-026-01656-0 PubMed 42032037