hTMEM115-TEV-3xHA-P2A-mNeonGreen HDR template
(Plasmid
#214999)
-
PurposeEndogenously tag human TMEM115 with a C-terminal 3xHA tag in addition to cytosolic mNG for cell sorting.
-
Depositing Lab
-
Depositing OrganizationHarvard Medical School
Located in the United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 214999 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 214999-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 214999-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepTwist-Amp
-
Vector typeHDR template
-
Selectable markersmNeonGreen
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehTMEM115-TEV-3xHA-P2A-mNeonGreen HDR template
-
SpeciesH. sapiens (human)
-
Entrez GeneTMEM115 (a.k.a. PL6)
- Promoter None
-
Tag
/ Fusion Protein
- 3xHA (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer Unknown
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Use either of the following guides: GTCTGGAGTTACAGCGTCGGGGG or CCGCTCATTGAGTGCCTTCAGGG (in both cases, the PAM is the final GGG) . Additional data, code, and other details related to this work (Hollingsworth et al. 2024) are available at https://harperlab.pubpub.org/pub/nlrp3/.
DNA (Catalog # 214999-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 214999-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
hTMEM115-TEV-3xHA-P2A-mNeonGreen HDR template was a gift from Wade Harper (Addgene plasmid # 214999 ; http://n2t.net/addgene:214999 ; RRID:Addgene_214999) -
For your References section:
Spatiotemporal proteomic profiling of cellular responses to NLRP3 agonists. Hollingsworth LR, Veeraraghavan P, Paulo JA, Harper JW. bioRxiv 2024.04.19.590338 10.1101/2024.04.19.590338