Skip to main content

pDsRed2-Keap1
(Plasmid #21551)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 21551 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 21551-D50 50 μg of DNA in Tris buffer $495
DNA 21551-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pDsRed2-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 3300
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    kelch-like ECH-associated protein 1
  • Alt name
    KEAP1
  • Alt name
    INrf2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1879
  • GenBank ID
    Q14145
  • Entrez Gene
    KEAP1 (a.k.a. INrf2, KLHL19)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer 5'd[GTACTGGAACTGGGGGGACAG]
  • 3′ sequencing primer n/a
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDsRed2-Keap1 was a gift from Yue Xiong (Addgene plasmid # 21551 ; http://n2t.net/addgene:21551 ; RRID:Addgene_21551)
  • For your References section:

    BTB protein Keap1 targets antioxidant transcription factor Nrf2 for ubiquitination by the Cullin 3-Roc1 ligase. Furukawa M, Xiong Y. Mol Cell Biol. 2005 Jan . 25(1):162-71. 10.1128/MCB.25.1.162-171.2005 PubMed 15601839