-
Depositing Lab
-
Depositing OrganizationUniversity of North Carolina at Chapel Hill
Located in the United States of America -
Publication
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 21551 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 21551-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 21551-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepDsRed2-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3300
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namekelch-like ECH-associated protein 1
-
Alt nameKEAP1
-
Alt nameINrf2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1879
-
GenBank IDQ14145
-
Entrez GeneKEAP1 (a.k.a. INrf2, KLHL19)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer 5'd[GTACTGGAACTGGGGGGACAG]
- 3′ sequencing primer n/a
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 21551-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 21551-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDsRed2-Keap1 was a gift from Yue Xiong (Addgene plasmid # 21551 ; http://n2t.net/addgene:21551 ; RRID:Addgene_21551) -
For your References section:
BTB protein Keap1 targets antioxidant transcription factor Nrf2 for ubiquitination by the Cullin 3-Roc1 ligase. Furukawa M, Xiong Y. Mol Cell Biol. 2005 Jan . 25(1):162-71. 10.1128/MCB.25.1.162-171.2005 PubMed 15601839