Skip to main content

pcDNAintron-CHIKV-capsid protein
(Plasmid #215701)

Ordering

Currently unavailable outside the U.S.
Item Catalog # Description Quantity Price (USD)
Plasmid 215701 Standard format: Plasmid sent in bacteria as agar stab 1 $94 *
DNA 215701-D50 50 μg of DNA in Tris buffer $495 *
DNA 215701-D100 100 μg of DNA in Tris buffer $585 *

* Log in to view industry pricing.

Backbone

  • Vector backbone
    pcDNAintron
  • Backbone size w/o insert (bp) 6205
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CHIKV capsid
  • Species
    Chikungunya virus strain 181/clone 25
  • Insert Size (bp)
    782
  • Promoter CMV

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNAintron-CHIKV-capsid protein was a gift from Melinda Brindley (Addgene plasmid # 215701 ; http://n2t.net/addgene:215701 ; RRID:Addgene_215701)
  • For your References section:

    Chikungunya virus release is reduced by TIM-1 receptors through binding of envelope phosphatidylserine. Reyes Ballista JM, Hoover AJ, Noble JT, Acciani MD, Miazgowicz KL, Harrison SA, Tabscott GAL, Duncan A, Barnes DN, Jimenez AR, Brindley MA. J Virol. 2024 Jul 15:e0077524. doi: 10.1128/jvi.00775-24. 10.1128/jvi.00775-24 PubMed 39007616