pcDNAintron-CDC50A-c3xFLAG
(Plasmid
#215702)
-
PurposeProduces human CDC50A-c3xFLAG, a chaperone to phosphatidylserine flippase complexes
-
Depositing Lab
-
Depositing OrganizationUniversity of Georgia
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 215702 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 * | |
| DNA | 215702-D50 | 50 μg of DNA in Tris buffer | $495 * | ||
| DNA | 215702-D100 | 100 μg of DNA in Tris buffer | $585 * | ||
* Log in to view industry pricing.
Backbone
-
Vector backbonepcDNAintron
- Backbone size w/o insert (bp) 6205
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCDC50A
-
Alt nameTMEM30a
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1154
-
Entrez GeneTMEM30A (a.k.a. C6orf67, CDC50A)
- Promoter CMV
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 215702-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 215702-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNAintron-CDC50A-c3xFLAG was a gift from Melinda Brindley (Addgene plasmid # 215702 ; http://n2t.net/addgene:215702 ; RRID:Addgene_215702) -
For your References section:
Chikungunya virus release is reduced by TIM-1 receptors through binding of envelope phosphatidylserine. Reyes Ballista JM, Hoover AJ, Noble JT, Acciani MD, Miazgowicz KL, Harrison SA, Tabscott GAL, Duncan A, Barnes DN, Jimenez AR, Brindley MA. J Virol. 2024 Jul 15:e0077524. doi: 10.1128/jvi.00775-24. 10.1128/jvi.00775-24 PubMed 39007616