pIDTSmart-MbPylRS
(Plasmid
#217361)
-
PurposeExpresses Methanosarcina barkeri aminoacyl-tRNA synthetases; can be packaged into bacmid
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 217361 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepIDT-Smart-CMV
- Backbone size w/o insert (bp) 3077
- Total vector size (bp) 4337
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameM. barkeri pyrrolysyl-tRNA synthetase
-
SpeciesMethanosarcina barkeri
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer GGGTTCTTTCCGCCTCAGAAGCC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIDTSmart-MbPylRS was a gift from Abhishek Chatterjee (Addgene plasmid # 217361 ; http://n2t.net/addgene:217361 ; RRID:Addgene_217361) -
For your References section:
Virus-assisted directed evolution of enhanced suppressor tRNAs in mammalian cells. Jewel D, Kelemen RE, Huang RL, Zhu Z, Sundaresh B, Cao X, Malley K, Huang Z, Pasha M, Anthony J, van Opijnen T, Chatterjee A. Nat Methods. 2023 Jan;20(1):95-103. doi: 10.1038/s41592-022-01706-w. Epub 2022 Dec 22. 10.1038/s41592-022-01706-w PubMed 36550276