pIDTSmart-MbPylRS
(Plasmid #217361)

• Purpose: Expresses Methanosarcina barkeri aminoacyl-tRNA synthetases; can be packaged into bacmid
• Depositing Lab: Abhishek Chatterjee
• Publication: Jewel et al Nat Methods. 2023 Jan;20(1):95-103. doi: 10.1038/s41592-022-01706-w. Epub 2022 Dec 22.

Backbone

• Vector backbone: pIDT-Smart-CMV
• Backbone size w/o insert (bp): 3077
• Total vector size (bp): 4337
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: M. barkeri pyrrolysyl-tRNA synthetase
• Species: Methanosarcina barkeri
• Promoter: CMV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: GGGTTCTTTCCGCCTCAGAAGCC

Resource Information

• Supplemental Documents:
  • pidtsmart-mbpylrs (1).gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry