Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pMAH-POLY-eRF1(E55D)
(Plasmid #157925)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 157925 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMAH
  • Backbone size w/o insert (bp) 7583
  • Total vector size (bp) 10256
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    POLY-eRF1(E55D), Polyspecific aminoacyl-tRNA Synthetase fused to a modified releasing factor through 2A peptide
  • Insert Size (bp)
    2673
  • Promoter CMV

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer ACA CAT ACG ATT TAG GTG ACA CTA TAG AAT
  • 3′ sequencing primer ATGAAAGCCATACGGGAAGCAATAGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid can be used in mammalian cells to genetically encode an array of para-substituted phenylalanine analogs, including p-boronophenylalaine (pBoF), p-azidophenylalanine (pAzF), p-acetylphenylalanine (pAcF), p-iodophenylalanine (pIoF), p-bromophenylalanine (pBrF), p-cyanophenylalanine (pCNF), p-nitrophenylalanine (pNO2F), p-benzoylphenylalanine (pBzF), 4,4′-biphenylalanine (BIF), O-methyl-tyrosine (OMeY), O-propargyl-tyrosine (OPrY), and O-allyl-tyrosine.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMAH-POLY-eRF1(E55D) was a gift from Huiwang Ai (Addgene plasmid # 157925 ; http://n2t.net/addgene:157925 ; RRID:Addgene_157925)
  • For your References section:

    A high-performance genetically encoded fluorescent biosensor for imaging physiological peroxynitrite. Chen Z, Zhang S, Li X, Ai HW. Cell Chem Biol. 2021 Jan 27. pii: S2451-9456(21)00013-1. doi: 10.1016/j.chembiol.2021.01.013. 10.1016/j.chembiol.2021.01.013 PubMed 33581056