pIRE4-Azi
(Plasmid #105829)

• Purpose: Plasmid encoding for the translational pair that enables efficent incoporation of p-Azido-phenylalanine in response to the amber codon into proteins in mammmalian cells
• Depositing Lab: Irene Coin
• Publication: Seidel et al Elife. 2017 Aug 3;6. doi: 10.7554/eLife.27711.

Backbone

• Vector backbone: pEGFP-N1
• Backbone manufacturer: Clontech
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Humanized EAziRS
• Species: Synthetic
• Mutation: (Y37L, D182S, F183M, L186A, D265R)TyrRS
• Promoter: PGK

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: Unknown (unknown if destroyed)
• 3′ cloning site: Unknown (unknown if destroyed)
• 5′ sequencing primer: mPGK-F 5' cattctgcacgcttcaaaag 3'

Gene/Insert 2

• Gene/Insert name: 4 copies of the U6-BstYam tRNA cassette
• Species: Synthetic
• Promoter: U6

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: Unknown (unknown if destroyed)
• 3′ cloning site: Unknown (unknown if destroyed)
• 5′ sequencing primer: Unknown

Resource Information

• Supplemental Documents:
  • pIRE4-Azi.gb
• A portion of this plasmid was derived from a plasmid made by: The humanized EAziRS gene was synthesized by Invitrogen GeneArt Gene Synthesis (Germany)/ThermoFisher Scientific (Waltham, MA).
• Articles Citing this Plasmid:
  • 5 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The plasmid has been developed for efficient incorporation of Azi into GPCRs, first used in Seidel et al. eLIFE 2017. With respect to similar plasmids from other labs, this plasmid contains a humanized gene for EAziRS and 4 copies of the U6-BstYam tRNA cassette right downstream of the synthetase cassette.