pMAH-pnGFP-Ultra
(Plasmid
#157924)
-
PurposePeroxynitrite sensor pnGFP-Ultra in mammalian cells (use with pMAH-POLY-eRF1(E55D))
-
Depositing Lab
-
Depositing OrganizationUniversity of Virginia
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 157924 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 157924-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 157924-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepMAH
- Backbone size w/o insert (bp) 6981
- Total vector size (bp) 7761
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namepnGFP-Ultra
-
Insert Size (bp)780
- Promoter cmv
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ACA CAT ACG ATT TAG GTG ACA CTA TAG AAT
- 3′ sequencing primer ATGAAAGCCATACGGGAAGCAATAGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 157924-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 157924-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMAH-pnGFP-Ultra was a gift from Huiwang Ai (Addgene plasmid # 157924 ; http://n2t.net/addgene:157924 ; RRID:Addgene_157924) -
For your References section:
A high-performance genetically encoded fluorescent biosensor for imaging physiological peroxynitrite. Chen Z, Zhang S, Li X, Ai HW. Cell Chem Biol. 2021 Jan 27. pii: S2451-9456(21)00013-1. doi: 10.1016/j.chembiol.2021.01.013. 10.1016/j.chembiol.2021.01.013 PubMed 33581056