Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pEvol-pAzFRS.2.t1
(Plasmid #73546)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 73546 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Turbo
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    pAzFRS.2.t1
  • Species
    Synthetic
  • Insert Size (bp)
    921
  • GenBank ID
    KT996140

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site bglII (unknown if destroyed)
  • 3′ cloning site SalI (unknown if destroyed)
  • 5′ sequencing primer cataagattagcggatcctacctg
  • 3′ sequencing primer CTTCTGCGTTCTGATTTAATCTG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    pAzFRS.2.t1
  • Species
    Synthetic
  • GenBank ID
    KT996140

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site ndeI (not destroyed)
  • 3′ cloning site pstI (not destroyed)
  • 5′ sequencing primer CAGATTAAATCAGAACGCAGAAG
  • 3′ sequencing primer cgaaagcaaattcgaccct
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Note: This plasmid exists as a tandem dimer approximately 12 kb in length. Please see the diagnostic digest in the Resource Information section.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEvol-pAzFRS.2.t1 was a gift from Farren Isaacs (Addgene plasmid # 73546 ; http://n2t.net/addgene:73546 ; RRID:Addgene_73546)
  • For your References section:

    Evolution of translation machinery in recoded bacteria enables multi-site incorporation of nonstandard amino acids. Amiram M, Haimovich AD, Fan C, Wang YS, Aerni HR, Ntai I, Moonan DW, Ma NJ, Rovner AJ, Hong SH, Kelleher NL, Goodman AL, Jewett MC, Soll D, Rinehart J, Isaacs FJ. Nat Biotechnol. 2015 Dec;33(12):1272-1279. doi: 10.1038/nbt.3372. Epub 2015 Nov 16. 10.1038/nbt.3372 PubMed 26571098