Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pEVOL-pAzF
(Plasmid #31186)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 31186 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    p15A
  • Backbone size w/o insert (bp) 5000
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Any strain for growth, 37 oC, LB/2XYT media
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    M.j. p-azidohenylalanine RS (2 copies +tRNA)
  • Alt name
    pEVOL-pAz
  • Species
    M.jannaschii
  • Insert Size (bp)
    1000
  • Mutation
    Y32T, E107N, D158P, I159L, L162Q, D286R

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer ATTAGCGGATCCTACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATACCCGTTTTTT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEVOL-pAzF was a gift from Peter Schultz (Addgene plasmid # 31186 ; http://n2t.net/addgene:31186 ; RRID:Addgene_31186)
  • For your References section:

    Addition of p-azido-L-phenylalanine to the genetic code of Escherichia coli. Chin JW, Santoro SW, Martin AB, King DS, Wang L, Schultz PG. J Am Chem Soc. 2002 Aug 7;124(31):9026-7. 10.1021/ja027007w PubMed 12148987