Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pEVOL-pBpF
(Plasmid #31190)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 31190 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Any strain for growth, 37 oC, LB/2XYT media
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    M.j. p-benzoylphenylalanine RS (2 copies +tRNA)
  • Alt name
    pEVOL-pBpF
  • Species
    M.jannaschii
  • Insert Size (bp)
    1000
  • Mutation
    Y32G, E107P, D158T, I159S

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer ATTAGCGGATCCTACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATACCCGTTTTTT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEVOL-pBpF was a gift from Peter Schultz (Addgene plasmid # 31190 ; http://n2t.net/addgene:31190 ; RRID:Addgene_31190)
  • For your References section:

    Addition of a photocrosslinking amino acid to the genetic code of Escherichiacoli. Chin JW, Martin AB, King DS, Wang L, Schultz PG. Proc Natl Acad Sci U S A. 2002 Aug 20;99(17):11020-4. Epub 2002 Aug 1. 10.1073/pnas.172226299 PubMed 12154230