Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEvol-pAzFRS.1.t1
(Plasmid #73547)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 73547 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    p15A
  • Backbone size w/o insert (bp) 5000
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Turbo
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    pAzFRS.1.t1
  • Species
    Synthetic
  • Insert Size (bp)
    921
  • GenBank ID
    KT996138

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site bglII (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer cataagattagcggatcctacctg
  • 3′ sequencing primer CTTCTGCGTTCTGATTTAATCTG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    pAzFRS.1.t1
  • Insert Size (bp)
    921
  • GenBank ID
    KT996138

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEvol-pAzFRS.1.t1 was a gift from Farren Isaacs (Addgene plasmid # 73547 ; http://n2t.net/addgene:73547 ; RRID:Addgene_73547)
  • For your References section:

    Evolution of translation machinery in recoded bacteria enables multi-site incorporation of nonstandard amino acids. Amiram M, Haimovich AD, Fan C, Wang YS, Aerni HR, Ntai I, Moonan DW, Ma NJ, Rovner AJ, Hong SH, Kelleher NL, Goodman AL, Jewett MC, Soll D, Rinehart J, Isaacs FJ. Nat Biotechnol. 2015 Dec;33(12):1272-1279. doi: 10.1038/nbt.3372. Epub 2015 Nov 16. 10.1038/nbt.3372 PubMed 26571098