pIDTSmart-CMV-PLRS1
(Plasmid
#217365)
-
PurposeExpression of previously developed E. coli leucyl aminoacyl-tRNA synthesis variant that is "polyspecific"
-
Depositing Lab
-
Depositing OrganizationBoston College
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 217365 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 217365-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 217365-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepIDT-Smart
- Backbone size w/o insert (bp) 2302
- Total vector size (bp) 5558
-
Modifications to backboneintroduced CMV-PLRS1 mutant
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameleucyl-tRNA synthetase polyspecific mutant
-
Alt nameLeuRS
-
Alt namePLRS1
-
Alt namepolyLeuRS
-
SpeciesE. coli
-
Insert Size (bp)3256
-
MutationM40I, T252A, Y499I, Y527A, H529G
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AvrII (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GCCGTAAGATCACGGGTCGCAG
- 3′ sequencing primer CACGGGGGAGGGGCAAAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 217365-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 217365-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pIDTSmart-CMV-PLRS1 was a gift from Abhishek Chatterjee (Addgene plasmid # 217365 ; http://n2t.net/addgene:217365 ; RRID:Addgene_217365) -
For your References section:
Directed Evolution of a Bacterial Leucyl tRNA in Mammalian Cells for Enhanced Noncanonical Amino Acid Mutagenesis. Huang RL, Jewel D, Kelemen RE, Pham Q, Yared TJ, Wang S, Singha Roy SJ, Huang Z, Levinson SD, Sundaresh B, Miranda SE, van Opijnen T, Chatterjee A. ACS Synth Biol. 2024 Jul 19;13(7):2141-2149. doi: 10.1021/acssynbio.4c00196. Epub 2024 Jun 21. 10.1021/acssynbio.4c00196 PubMed 38904157
Map uploaded by the depositor.
