Skip to main content

pAAV-ITR-CMV-mCherry-1xU6-LtR-wt(TAG)
(Plasmid #217366)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 217366 Standard format: Plasmid sent in bacteria as agar stab 1 $94

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV-ITR-mCherry
  • Backbone size w/o insert (bp) 5498
  • Total vector size (bp) 5854
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    E. coli leucine tRNA for TAG suppression
  • Alt name
    LtR
  • Alt name
    tRNA-Leu
  • Alt name
    EcLtR
  • Species
    E. coli
  • Insert Size (bp)
    356
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer CTGCGGCCGCACGCGTCTCGCGGTCCAG
  • 3′ sequencing primer GCTGCTCTCGTCGATCCGCTAGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    from Wu N, Deiters A, Cropp TA, King D, Schultz PG. A genetically encoded photocaged amino acid. J Am Chem Soc. 2004 Nov 10;126(44):14306-7. doi: 10.1021/ja040175z. PMID: 15521721.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-ITR-CMV-mCherry-1xU6-LtR-wt(TAG) was a gift from Abhishek Chatterjee (Addgene plasmid # 217366 ; http://n2t.net/addgene:217366 ; RRID:Addgene_217366)
  • For your References section:

    Directed Evolution of a Bacterial Leucyl tRNA in Mammalian Cells for Enhanced Noncanonical Amino Acid Mutagenesis. Huang RL, Jewel D, Kelemen RE, Pham Q, Yared TJ, Wang S, Singha Roy SJ, Huang Z, Levinson SD, Sundaresh B, Miranda SE, van Opijnen T, Chatterjee A. ACS Synth Biol. 2024 Jul 19;13(7):2141-2149. doi: 10.1021/acssynbio.4c00196. Epub 2024 Jun 21. 10.1021/acssynbio.4c00196 PubMed 38904157