LCV2 IRF3 KO
(Plasmid
#217446)
-
PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human IRF3
-
Depositing Lab
-
Depositing OrganizationUniversity of Utah
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 217446 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonelentiCRISPRv2
-
Vector typeMammalian Expression, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA targeting IRF3
-
Alt nameIRF3
-
gRNA/shRNA sequenceCGTGCGGCTCTTGTTCACCC
-
SpeciesH. sapiens (human)
-
Entrez GeneIRF3 (a.k.a. IIAE7)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LCV2 IRF3 KO was a gift from Jarrod Johnson (Addgene plasmid # 217446 ; http://n2t.net/addgene:217446 ; RRID:Addgene_217446) -
For your References section:
Cell-free assays reveal that the HIV-1 capsid protects reverse transcripts from cGAS immune sensing. Scott TM, Arnold LM, Powers JA, McCann DA, Rowe AB, Christensen DE, Pereira MJ, Zhou W, Torrez RM, Iwasa JH, Kranzusch PJ, Sundquist WI, Johnson JS. PLoS Pathog. 2025 Jan 28;21(1):e1012206. doi: 10.1371/journal.ppat.1012206. 10.1371/journal.ppat.1012206 PubMed 39874383