-
PurposeExpresses tdTomato-tDeg fluorogenic protein in mammalian cells with miniCMV promoter
-
Depositing Lab
-
Depositing OrganizationBeijing Institutes of Life Science, Chinese Academy of Sciences
Located in China -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 217521 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 217521-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 217521-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 1581
- Total vector size (bp) 6362
-
Vector typeMammalian Expression
-
Selectable markersNo other marker
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsNo additional growing instructions
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametdTomato-tDeg fluorogenic protein
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1581
- Promoter miniCMV
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
DNA (Catalog # 217521-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 217521-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
miniCMV-tdTomato-tDeg was a gift from Xing Li (Addgene plasmid # 217521 ; http://n2t.net/addgene:217521 ; RRID:Addgene_217521) -
For your References section:
Fluorogenic CRISPR for genomic DNA imaging. Zhang Z, Rong X, Xie T, Li Z, Song H, Zhen S, Wang H, Wu J, Jaffrey SR, Li X. Nat Commun. 2024 Jan 31;15(1):934. doi: 10.1038/s41467-024-45163-9. 10.1038/s41467-024-45163-9 PubMed 38296979
Map uploaded by the depositor.
